HS-GC-IMS-Based metabonomics study of Baihe Jizihuang Tang in a rat model of chronic unpredictable mild stress.

The aim of this study was to investigate the differences in volatile organic compounds (VOCs) obtained from the feces of a Baihe Jizihuang Tang (BHT)-treated rat depression model. Rats were subjected to chronic unpredictable mild stress (CUMS), and the differences in VOCs were analyzed by headspace-gas chromatography-ion mobility spectrometry (HS-GC-IMS), NIST software, principal component analysis, and orthogonal partial least squares discriminant analysis.

Eleven biomarkers were identified on the basis of VOC migration time, and their relative peak intensities were analyzed. A metabonomic model was established using multivariate statistical analysis.

The study demonstrated the metabonomics of CUMS rats and the intervention effect of BHT and also highlighted the potential therapeutic effects of the traditional Chinese medicine (TCM) Jingfang for the clinical treatment of complex diseases, which was in line with the holistic and systemic approaches of TCM.

Human Hemopexin (HPX) ELISA Kit

DL-HPX-Hu-96 1 kit of 96 tests
EUR 547.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Hemopexin (HPX)

Rat Hemopexin (HPX) ELISA Kit

DL-HPX-Ra-192 1 kit of 192 tests
EUR 1183.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Hemopexin (HPX)

Rat Hemopexin (HPX) ELISA Kit

DL-HPX-Ra-48 1 kit of 48 tests
EUR 493.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Hemopexin (HPX)

Rat Hemopexin (HPX) ELISA Kit

DL-HPX-Ra-96 1 kit of 96 tests
EUR 661.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Hemopexin (HPX)

Human Hemopexin (HPX) ELISA Kit

DLR-HPX-Hu-48T 48T
EUR 441.00
  • Should the Human Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Human Hemopexin (HPX) ELISA Kit

DLR-HPX-Hu-96T 96T
EUR 570.00
  • Should the Human Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Rat Hemopexin (HPX) ELISA Kit

DLR-HPX-Ra-48T 48T
EUR 528.00
  • Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Rat Hemopexin (HPX) ELISA Kit

DLR-HPX-Ra-96T 96T
EUR 690.00
  • Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Human Hemopexin (HPX) ELISA Kit

RD-HPX-Hu-48Tests 48 Tests
EUR 436.00

Human Hemopexin (HPX) ELISA Kit

RD-HPX-Hu-96Tests 96 Tests
EUR 601.00

Rat Hemopexin (HPX) ELISA Kit

RD-HPX-Ra-48Tests 48 Tests
EUR 534.00

Rat Hemopexin (HPX) ELISA Kit

RD-HPX-Ra-96Tests 96 Tests
EUR 742.00

Human Hemopexin (HPX) ELISA Kit

RDR-HPX-Hu-48Tests 48 Tests
EUR 455.00

Human Hemopexin (HPX) ELISA Kit

RDR-HPX-Hu-96Tests 96 Tests
EUR 629.00

Rat Hemopexin (HPX) ELISA Kit

RDR-HPX-Ra-48Tests 48 Tests
EUR 558.00

Rat Hemopexin (HPX) ELISA Kit

RDR-HPX-Ra-96Tests 96 Tests
EUR 776.00

Mouse Hemopexin (Hpx) ELISA kit 96 tests, Quantitative

600-700-HPX 1 Kit
EUR 773.00

Hpx Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

HPX antibody

70R-33157 100 ug
EUR 435.00
Description: Rabbit polyclonal HPX antibody

HPX Antibody

ABD7415 100 ug
EUR 438.00

HPX Antibody

32919-100ul 100ul
EUR 252.00


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPX Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HPX Antibody

DF7415 200ul
EUR 304.00
Description: HPX Antibody detects endogenous levels of total HPX.

Rat Hemopexin (Hpx)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in Yeast

Hpx Polyclonal Antibody

A52880 100 µg
EUR 570.55
Description: Ask the seller for details

Hemopexin (HPX) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx032918-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx032918-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx037974-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HPX cloning plasmid

CSB-CL010723HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggctagggtactgggagcacccgttgcactggggttgtggagcctatgctggtctctggccattgccacccctcttcctccgactagtgcccatgggaatgttgctgaaggcgagaccaagccagacccagacgtgactgaacgctgctcagatggctggagctttgatgctac
  • Show more
Description: A cloning plasmid for the HPX gene.

Hemopexin (HPX) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

  • EUR 718.00
  • EUR 384.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

abx233829-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

HPX Conjugated Antibody

C32919 100ul
EUR 397.00

Hemopexin (HPX) Antibody

abx018663-100ul 100 ul
EUR 342.00
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 843.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Hemopexin (Hpx)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in E.coli

Recombinant Hemopexin (HPX)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02790
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02790
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20059
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20059
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

HPX Rabbit pAb

A5603-100ul 100 ul
EUR 308.00

HPX Rabbit pAb

A5603-200ul 200 ul
EUR 459.00

HPX Rabbit pAb

A5603-20ul 20 ul
EUR 183.00

HPX Rabbit pAb

A5603-50ul 50 ul
EUR 223.00

HPX Blocking Peptide

DF7415-BP 1mg
EUR 195.00

Hpx sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3830503 1.0 ug DNA
EUR 154.00

HPX sgRNA CRISPR Lentivector (Human) (Target 2)

K0988303 1.0 ug DNA
EUR 154.00

Hpx sgRNA CRISPR Lentivector (Rat) (Target 2)

K6850703 1.0 ug DNA
EUR 154.00

Hpx Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Hpx Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Hpx Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat HPX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HPX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HPX protein (His tag)

80R-3694 100 ug
EUR 327.00
Description: Purified recombinant HPX protein (His tag)

Hemopexin (HPX) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human HPX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Hemopexin (HPX) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)

  • EUR 398.00
  • EUR 230.00
  • EUR 1080.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hemopexin (HPX) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Hemopexin (HPX) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein

  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Hemopexin (HPX) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein

  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cow Hemopexin (HPX) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

HPX Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HPX Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HPX Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF006125 96 Tests
EUR 689.00


ELA-E1986h 96 Tests
EUR 824.00

HPX Recombinant Protein (Rat)

RP205049 100 ug Ask for price

HPX Recombinant Protein (Human)

RP015217 100 ug Ask for price

HPX Recombinant Protein (Mouse)

RP142346 100 ug Ask for price


EMH0117 96Tests
EUR 521.00

Anserini HPX ELISA Kit

EAH0117 96Tests
EUR 521.00

Bovine HPX ELISA Kit

EBH0117 96Tests
EUR 521.00

Polyclonal HPX / Hemopexin Antibody

APR07793G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody

APR07794G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody

APR07795G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX Antibody (Center)

APR07796G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX (Center). This antibody is tested and proven to work in the following applications:


EHH0117 96Tests
EUR 521.00


EGTH0117 96Tests
EUR 521.00

Canine HPX ELISA Kit

ECH0117 96Tests
EUR 521.00

Chicken HPX ELISA Kit

ECKH0117 96Tests
EUR 521.00


ESH0117 96Tests
EUR 521.00

Porcine HPX ELISA Kit

EPH0117 96Tests
EUR 521.00

Monkey HPX ELISA Kit

EMKH0117 96Tests
EUR 521.00


ERH0117 96Tests
EUR 521.00

Rabbit HPX ELISA Kit

ERTH0117 96Tests
EUR 521.00

Hpx Polyclonal Antibody, Biotin Conjugated

A52877 100 µg
EUR 570.55
Description: reagents widely cited

Hpx Polyclonal Antibody, FITC Conjugated

A52878 100 µg
EUR 570.55
Description: Ask the seller for details

Hpx Polyclonal Antibody, HRP Conjugated

A52879 100 µg
EUR 570.55
Description: The best epigenetics products

Human Hemopexin (HPX) ELISA Kit

  • EUR 6173.00
  • EUR 3291.00
  • EUR 770.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemopexin (HPX) ELISA Kit

abx570433-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Mouse Hemopexin (HPX) ELISA Kit

abx519046-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Pig Hemopexin (HPX) ELISA Kit

abx519047-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Chicken Hemopexin (HPX) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Hemopexin (HPX) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Hemopexin (HPX) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Hemopexin (HPX) ELISA Kit

abx255717-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Chicken Hemopexin (HPX) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Hemopexin (HPX) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Hemopexin (HPX) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Hemopexin (HPX) CLIA Kit

abx197132-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

This study augments the use of metabonomics based on HS-GC-IMS in research studies. Using this method, there is no need to pre-process samples by extraction or derivatization, and the VOC component of the sample can be detected directly and rapidly. In conclusion, this study establishes a simple, convenient, and fast technique, which can help identify clinical biomarkers for rapid medical diagnosis.