HS-GC-IMS-Based metabonomics study of Baihe Jizihuang Tang in a rat model of chronic unpredictable mild stress.

The aim of this study was to investigate the differences in volatile organic compounds (VOCs) obtained from the feces of a Baihe Jizihuang Tang (BHT)-treated rat depression model. Rats were subjected to chronic unpredictable mild stress (CUMS), and the differences in VOCs were analyzed by headspace-gas chromatography-ion mobility spectrometry (HS-GC-IMS), NIST software, principal component analysis, and orthogonal partial least squares discriminant analysis.

Eleven biomarkers were identified on the basis of VOC migration time, and their relative peak intensities were analyzed. A metabonomic model was established using multivariate statistical analysis.

The study demonstrated the metabonomics of CUMS rats and the intervention effect of BHT and also highlighted the potential therapeutic effects of the traditional Chinese medicine (TCM) Jingfang for the clinical treatment of complex diseases, which was in line with the holistic and systemic approaches of TCM.

Rat Hemopexin (HPX) ELISA Kit

DLR-HPX-Ra-48T 48T
EUR 528
  • Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Rat Hemopexin (HPX) ELISA Kit

DLR-HPX-Ra-96T 96T
EUR 690
  • Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Human Hemopexin (HPX) ELISA Kit

RD-HPX-Hu-48Tests 48 Tests
EUR 436

Human Hemopexin (HPX) ELISA Kit

RD-HPX-Hu-96Tests 96 Tests
EUR 601

Rat Hemopexin (HPX) ELISA Kit

RD-HPX-Ra-48Tests 48 Tests
EUR 534

Rat Hemopexin (HPX) ELISA Kit

RD-HPX-Ra-96Tests 96 Tests
EUR 742

Human Hemopexin (HPX) ELISA Kit

RDR-HPX-Hu-48Tests 48 Tests
EUR 455

Human Hemopexin (HPX) ELISA Kit

RDR-HPX-Hu-96Tests 96 Tests
EUR 629

Rat Hemopexin (HPX) ELISA Kit

RDR-HPX-Ra-48Tests 48 Tests
EUR 558

Rat Hemopexin (HPX) ELISA Kit

RDR-HPX-Ra-96Tests 96 Tests
EUR 776

Mouse Hemopexin (Hpx) ELISA kit 96 tests, Quantitative

600-700-HPX 1 Kit
EUR 773

HPX siRNA

20-abx902527
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPX siRNA

20-abx919837
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPX siRNA

20-abx919838
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPX antibody

70R-33157 100 ug
EUR 435
Description: Rabbit polyclonal HPX antibody

HPX Antibody

ABD7415 100 ug
EUR 438

HPX Antibody

32919-100ul 100ul
EUR 252

HPX Antibody

DF7415 200ul
EUR 304
Description: HPX Antibody detects endogenous levels of total HPX.

Hpx Antibody

1-CSB-PA010723LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

HPX Antibody

1-CSB-PA14619A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HPX Conjugated Antibody

C32919 100ul
EUR 397

HPX cloning plasmid

CSB-CL010723HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggctagggtactgggagcacccgttgcactggggttgtggagcctatgctggtctctggccattgccacccctcttcctccgactagtgcccatgggaatgttgctgaaggcgagaccaagccagacccagacgtgactgaacgctgctcagatggctggagctttgatgctac
  • Show more
Description: A cloning plasmid for the HPX gene.

Hemopexin (HPX) Antibody

20-abx130204
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

20-abx110423
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx141489
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx037974-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx100261
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

20-abx100262
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

20-abx100263
  • EUR 314.00
  • EUR 133.00
  • EUR 843.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

abx032918-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx032918-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx004282
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx018663-100ul 100 ul
EUR 342
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx172765
  • EUR 718.00
  • EUR 384.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx172766
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx172767
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx176803
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx176804
  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

abx233829-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Hemopexin (HPX) Antibody

20-abx302284
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hpx Polyclonal Antibody

A52880 100 µg
EUR 570.55
Description: Ask the seller for details

HPX Rabbit pAb

A5603-100ul 100 ul
EUR 308

HPX Rabbit pAb

A5603-200ul 200 ul
EUR 459

HPX Rabbit pAb

A5603-20ul 20 ul
EUR 183

HPX Rabbit pAb

A5603-50ul 50 ul
EUR 223

HPX Blocking Peptide

DF7415-BP 1mg
EUR 195

Rat Hemopexin (Hpx)

1-CSB-YP010723RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in Yeast

Rat Hemopexin (Hpx)

1-CSB-EP010723RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in E.coli

Recombinant Hemopexin (HPX)

4-RPB986Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02790
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

4-RPB986Hu02
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02790
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

4-RPB986Ra01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20059
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

4-RPB986Ra02
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20059
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

Anti-HPX antibody

STJ27570 100 µl
EUR 277
Description: This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress.

Hpx sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3830503 1.0 ug DNA
EUR 154

HPX sgRNA CRISPR Lentivector (Human) (Target 2)

K0988303 1.0 ug DNA
EUR 154

Hpx sgRNA CRISPR Lentivector (Rat) (Target 2)

K6850703 1.0 ug DNA
EUR 154

Polyclonal HPX / Hemopexin Antibody

APR07793G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody

APR07794G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody

APR07795G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX Antibody (Center)

APR07796G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX (Center). This antibody is tested and proven to work in the following applications:

Cow Hemopexin (HPX) Protein

20-abx653714
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat HPX shRNA Plasmid

20-abx985920
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HPX ELISA Kit

EHH0117 96Tests
EUR 521

Human HPX ELISA Kit

ELA-E1986h 96 Tests
EUR 824

Goat HPX ELISA Kit

EGTH0117 96Tests
EUR 521

Bovine HPX ELISA Kit

EBH0117 96Tests
EUR 521

Canine HPX ELISA Kit

ECH0117 96Tests
EUR 521

Chicken HPX ELISA Kit

ECKH0117 96Tests
EUR 521

Anserini HPX ELISA Kit

EAH0117 96Tests
EUR 521

HPX ELISA KIT|Human

EF006125 96 Tests
EUR 689

Porcine HPX ELISA Kit

EPH0117 96Tests
EUR 521

Rat HPX ELISA Kit

ERH0117 96Tests
EUR 521

Rabbit HPX ELISA Kit

ERTH0117 96Tests
EUR 521

Sheep HPX ELISA Kit

ESH0117 96Tests
EUR 521

Mouse HPX ELISA Kit

EMH0117 96Tests
EUR 521

Monkey HPX ELISA Kit

EMKH0117 96Tests
EUR 521

Human Hemopexin (HPX) Protein

20-abx067049
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein

20-abx067050
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Hemopexin (HPX) Protein

20-abx067051
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein

20-abx067052
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hemopexin (HPX) Antibody (HRP)

20-abx108976
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx106143
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)

20-abx107557
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (HRP)

20-abx316139
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)

20-abx316140
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx316141
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx271774
  • EUR 398.00
  • EUR 230.00
  • EUR 1080.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx273085
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

HPX protein (His tag)

80R-3694 100 ug
EUR 327
Description: Purified recombinant HPX protein (His tag)

Mouse HPX shRNA Plasmid

20-abx970889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HPX shRNA Plasmid

20-abx952232
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Hpx Antibody, HRP conjugated

1-CSB-PA010723LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Hpx Antibody, FITC conjugated

1-CSB-PA010723LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Hpx Antibody, Biotin conjugated

1-CSB-PA010723LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

HPX Antibody, HRP conjugated

1-CSB-PA14619B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HPX Antibody, FITC conjugated

1-CSB-PA14619C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HPX Antibody, Biotin conjugated

1-CSB-PA14619D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HPX Recombinant Protein (Human)

RP015217 100 ug Ask for price

HPX Recombinant Protein (Rat)

RP205049 100 ug Ask for price

HPX Recombinant Protein (Mouse)

RP142346 100 ug Ask for price

Mouse Hemopexin (HPX) ELISA Kit

abx519046-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Hemopexin (HPX) ELISA Kit

abx519047-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Hemopexin (HPX) ELISA Kit

abx570433-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Cow Hemopexin (HPX) ELISA Kit

abx575591-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Hemopexin (HPX) ELISA Kit

abx576333-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Guinea Pig HPX ELISA Kit

EGH0117 96Tests
EUR 521

Human HPX/ Hemopexin ELISA Kit

E1162Hu 1 Kit
EUR 571

Human HPX(Hemopexin) ELISA Kit

EH2031 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: P02790
  • Alias: HPX(Hemopexin)/Beta-1B-glycoprotein/beta-1B-glycoprotein//hemopexin/HX
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Bovine Hemopexin, HPX ELISA KIT

ELI-06384b 96 Tests
EUR 928

Human Hemopexin, HPX ELISA KIT

ELI-06385h 96 Tests
EUR 824

Mouse Hemopexin, Hpx ELISA KIT

ELI-06386m 96 Tests
EUR 865

Rat Hemopexin, Hpx ELISA KIT

ELI-06387r 96 Tests
EUR 886

Porcine Hemopexin, HPX ELISA KIT

ELI-06388p 96 Tests
EUR 928

Chicken Hemopexin, HPX ELISA KIT

ELI-06389c 96 Tests
EUR 928

Bovine Hemopexin (HPX)ELISA Kit

GA-E0001BV-48T 48T
EUR 336

Bovine Hemopexin (HPX)ELISA Kit

GA-E0001BV-96T 96T
EUR 534

Rat HPX(Hemopexin) ELISA Kit

ER1046 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P20059
  • Alias: HPX(Hemopexin)/Beta-1B-glycoprotein/beta-1B-glycoprotein//hemopexin/HX
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml

Rat Hemopexin (HPX) ELISA Kit

20-abx155626
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemopexin (HPX) ELISA Kit

20-abx151794
  • EUR 6173.00
  • EUR 3291.00
  • EUR 770.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemopexin (HPX) CLIA Kit

20-abx190171
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

This study augments the use of metabonomics based on HS-GC-IMS in research studies. Using this method, there is no need to pre-process samples by extraction or derivatization, and the VOC component of the sample can be detected directly and rapidly. In conclusion, this study establishes a simple, convenient, and fast technique, which can help identify clinical biomarkers for rapid medical diagnosis.