HS-GC-IMS-Based metabonomics study of Baihe Jizihuang Tang in a rat model of chronic unpredictable mild stress.

The aim of this study was to investigate the differences in volatile organic compounds (VOCs) obtained from the feces of a Baihe Jizihuang Tang (BHT)-treated rat depression model. Rats were subjected to chronic unpredictable mild stress (CUMS), and the differences in VOCs were analyzed by headspace-gas chromatography-ion mobility spectrometry (HS-GC-IMS), NIST software, principal component analysis, and orthogonal partial least squares discriminant analysis.

Eleven biomarkers were identified on the basis of VOC migration time, and their relative peak intensities were analyzed. A metabonomic model was established using multivariate statistical analysis.

The study demonstrated the metabonomics of CUMS rats and the intervention effect of BHT and also highlighted the potential therapeutic effects of the traditional Chinese medicine (TCM) Jingfang for the clinical treatment of complex diseases, which was in line with the holistic and systemic approaches of TCM.

Rat Hemopexin (HPX) ELISA Kit
DLR-HPX-Ra-48T	DL Develop	48T	EUR 528.00
Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Rat Hemopexin (HPX) ELISA Kit
DLR-HPX-Ra-96T	DL Develop	96T	EUR 690.00
Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Human Hemopexin (HPX) ELISA Kit
RDR-HPX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 455.00

Human Hemopexin (HPX) ELISA Kit
RDR-HPX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 629.00

Rat Hemopexin (HPX) ELISA Kit
RDR-HPX-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558.00

Rat Hemopexin (HPX) ELISA Kit
RDR-HPX-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776.00

Human Hemopexin (HPX) ELISA Kit
RD-HPX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436.00

Human Hemopexin (HPX) ELISA Kit
RD-HPX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601.00

Rat Hemopexin (HPX) ELISA Kit
RD-HPX-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534.00

Rat Hemopexin (HPX) ELISA Kit
RD-HPX-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742.00

Mouse Hemopexin (Hpx) ELISA kit 96 tests, Quantitative
600-700-HPX	Alpha Diagnostics	1 Kit	EUR 773.00

HPX Antibody
32919-100ul	SAB	100ul	EUR 252.00

HPX Antibody
1-CSB-PA14619A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HPX Antibody
DF7415	Affbiotech	200ul	EUR 304.00
Description: HPX Antibody detects endogenous levels of total HPX.

HPX antibody
70R-33157	Fitzgerald	100 ug	EUR 435.00
Description: Rabbit polyclonal HPX antibody

Hpx Antibody
1-CSB-PA010723LA01RA	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

HPX siRNA
20-abx902527	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

HPX siRNA
20-abx919837	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

HPX siRNA
20-abx919838	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

HPX Antibody
ABD7415	Lifescience Market	100 ug	EUR 438.00

Rat Hemopexin (Hpx)
1-CSB-EP010723RA	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	0 1 2 3 4 5
MW: 52.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in E.coli

Rat Hemopexin (Hpx)
1-CSB-YP010723RA	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	0 1 2 3 4 5
MW: 50.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in Yeast

HPX Blocking Peptide
DF7415-BP	Affbiotech	1mg	EUR 195.00

Hemopexin (HPX) Antibody
abx018663-100ul	Abbexa	100 ul	EUR 342.00
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody
20-abx004282	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody
20-abx176803	Abbexa	EUR 1177.00 EUR 578.00	0 1
Please enquire.

Hemopexin (HPX) Antibody
20-abx176804	Abbexa	EUR 1358.00 EUR 648.00	0 1
Please enquire.

Hemopexin (HPX) Antibody
20-abx100261	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	0 1 2 3 4
Shipped within 5-7 working days.

Hemopexin (HPX) Antibody
20-abx100262	Abbexa	EUR 356.00 EUR 133.00 EUR 996.00 EUR 495.00 EUR 300.00	0 1 2 3 4
Shipped within 5-7 working days.

Hemopexin (HPX) Antibody
20-abx100263	Abbexa	EUR 314.00 EUR 133.00 EUR 843.00 EUR 439.00 EUR 272.00	0 1 2 3 4
Shipped within 5-7 working days.

Hemopexin (HPX) Antibody
20-abx110423	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody
abx037974-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody
20-abx130204	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Hemopexin (HPX) Antibody
20-abx141489	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	0 1 2
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody
20-abx172765	Abbexa	EUR 718.00 EUR 384.00	0 1
Please enquire.

Hemopexin (HPX) Antibody
20-abx172766	Abbexa	EUR 843.00 EUR 439.00	0 1
Please enquire.

Hemopexin (HPX) Antibody
20-abx172767	Abbexa	EUR 871.00 EUR 453.00	0 1
Please enquire.

Hemopexin (HPX) Antibody
abx032918-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody
abx032918-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

HPX Conjugated Antibody
C32919	SAB	100ul	EUR 397.00

Hemopexin (HPX) Antibody
abx233829-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

Hemopexin (HPX) Antibody
20-abx302284	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

HPX cloning plasmid
CSB-CL010723HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 765 Sequence: atggctagggtactgggagcacccgttgcactggggttgtggagcctatgctggtctctggccattgccacccctcttcctccgactagtgcccatgggaatgttgctgaaggcgagaccaagccagacccagacgtgactgaacgctgctcagatggctggagctttgatgctac Show more
Description: A cloning plasmid for the HPX gene.

Hpx Polyclonal Antibody
A52880	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

HPX Rabbit pAb
A5603-100ul	Abclonal	100 ul	EUR 308.00

HPX Rabbit pAb
A5603-200ul	Abclonal	200 ul	EUR 459.00

HPX Rabbit pAb
A5603-20ul	Abclonal	20 ul	EUR 183.00

HPX Rabbit pAb
A5603-50ul	Abclonal	50 ul	EUR 223.00

Recombinant Hemopexin (HPX)
4-RPB986Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	0 1 2 3 4 5 6
Uniprot ID: P02790 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)
4-RPB986Hu02	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	0 1 2 3 4 5 6
Uniprot ID: P02790 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)
4-RPB986Ra01	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	0 1 2 3 4 5 6
Uniprot ID: P20059 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.9kDa Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)
4-RPB986Ra02	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	0 1 2 3 4 5 6
Uniprot ID: P20059 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.3kDa Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

Anti-HPX antibody
STJ27570	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress.

Hpx sgRNA CRISPR Lentivector (Rat) (Target 2)
K6850703	ABM	1.0 ug DNA	EUR 154.00

Hpx sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3830503	ABM	1.0 ug DNA	EUR 154.00

HPX sgRNA CRISPR Lentivector (Human) (Target 2)
K0988303	ABM	1.0 ug DNA	EUR 154.00

HPX Antibody, HRP conjugated
1-CSB-PA14619B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HPX Antibody, FITC conjugated
1-CSB-PA14619C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HPX Antibody, Biotin conjugated
1-CSB-PA14619D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HPX protein (His tag)
80R-3694	Fitzgerald	100 ug	EUR 327.00
Description: Purified recombinant HPX protein (His tag)

Hemopexin (HPX) Antibody (Biotin)
20-abx106143	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)
20-abx107557	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (HRP)
20-abx108976	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Human Hemopexin (HPX) Protein
20-abx067049	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	0 1 2 3 4
Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein
20-abx067050	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	0 1 2 3 4
Shipped within 5-12 working days.

Human Hemopexin (HPX) Protein
20-abx067051	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	0 1 2 3 4
Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein
20-abx067052	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	0 1 2 3 4
Shipped within 5-12 working days.

Human HPX ELISA Kit
EHH0117	Abclonal	96Tests	EUR 521.00

Human HPX ELISA Kit
ELA-E1986h	Lifescience Market	96 Tests	EUR 824.00

Goat HPX ELISA Kit
EGTH0117	Abclonal	96Tests	EUR 521.00

Bovine HPX ELISA Kit
EBH0117	Abclonal	96Tests	EUR 521.00

Canine HPX ELISA Kit
ECH0117	Abclonal	96Tests	EUR 521.00

Chicken HPX ELISA Kit
ECKH0117	Abclonal	96Tests	EUR 521.00

Anserini HPX ELISA Kit
EAH0117	Abclonal	96Tests	EUR 521.00

HPX ELISA KIT|Human
EF006125	Lifescience Market	96 Tests	EUR 689.00

Rat HPX shRNA Plasmid
20-abx985920	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Polyclonal HPX / Hemopexin Antibody
APR07793G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody
APR07794G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody
APR07795G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX Antibody (Center)
APR07796G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX (Center). This antibody is tested and proven to work in the following applications:

Hpx Antibody, HRP conjugated
1-CSB-PA010723LB01RA	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Hpx Antibody, FITC conjugated
1-CSB-PA010723LC01RA	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Hpx Antibody, Biotin conjugated
1-CSB-PA010723LD01RA	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hemopexin (HPX) Antibody (Biotin)
20-abx271774	Abbexa	EUR 398.00 EUR 230.00 EUR 1080.00 EUR 537.00 EUR 314.00	0 1 2 3 4
Shipped within 5-15 working days.

Hemopexin (HPX) Antibody (Biotin)
20-abx273085	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 356.00	0 1 2 3 4
Shipped within 5-15 working days.

Hemopexin (HPX) Antibody (HRP)
20-abx316139	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)
20-abx316140	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)
20-abx316141	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Cow Hemopexin (HPX) Protein
20-abx653714	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	0 1 2 3 4
Shipped within 5-15 working days.

Human HPX shRNA Plasmid
20-abx952232	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse HPX shRNA Plasmid
20-abx970889	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat HPX ELISA Kit
ERH0117	Abclonal	96Tests	EUR 521.00

Sheep HPX ELISA Kit
ESH0117	Abclonal	96Tests	EUR 521.00

Rabbit HPX ELISA Kit
ERTH0117	Abclonal	96Tests	EUR 521.00

Mouse HPX ELISA Kit
EMH0117	Abclonal	96Tests	EUR 521.00

Monkey HPX ELISA Kit
EMKH0117	Abclonal	96Tests	EUR 521.00

Porcine HPX ELISA Kit
EPH0117	Abclonal	96Tests	EUR 521.00

HPX Recombinant Protein (Human)
RP015217	ABM	100 ug	Ask for price

HPX Recombinant Protein (Rat)
RP205049	ABM	100 ug	Ask for price

HPX Recombinant Protein (Mouse)
RP142346	ABM	100 ug	Ask for price

Human Hemopexin, HPX ELISA Kit
DEIA255	Creative Diagnostics	5 plates	EUR 1361.00
Description: The human HPX ELISA kit is for the quantitative determination of human HPX.

Pig HPX/ Hemopexin ELISA Kit
E0088Pi	Sunlong	1 Kit	EUR 717.00

Human Hemopexin (HPX) CLIA Kit
20-abx190171	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	0 1 2
Shipped within 5-7 working days.

Rat Hemopexin (HPX) CLIA Kit
abx197132-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Rat Hemopexin (HPX) ELISA Kit
20-abx155626	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	0 1 2
Shipped within 5-7 working days.

Human Hemopexin (HPX) ELISA Kit
20-abx151794	Abbexa	EUR 6173.00 EUR 3291.00 EUR 770.00	0 1 2
Shipped within 5-7 working days.

Rat Hemopexin (HPX) ELISA Kit
abx255717-96tests	Abbexa	96 tests	EUR 707.00
Shipped within 5-12 working days.

Chicken Hemopexin (HPX) ELISA Kit
20-abx258512	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	0 1 2
Shipped within 5-7 working days.

Mouse Hemopexin (HPX) ELISA Kit
20-abx258513	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	0 1 2
Shipped within 5-7 working days.

Human Hemopexin (HPX) ELISA Kit
abx251358-96tests	Abbexa	96 tests	EUR 707.00
Shipped within 5-12 working days.

Guinea Pig HPX ELISA Kit
EGH0117	Abclonal	96Tests	EUR 521.00

Human HPX/ Hemopexin ELISA Kit
E1162Hu	Sunlong	1 Kit	EUR 571.00

Human HPX(Hemopexin) ELISA Kit
EH2031	FN Test	96T	EUR 524.10
Detection range: 1.563-100 ng/ml Uniprot ID: P02790 Alias: HPX(Hemopexin)/Beta-1B-glycoprotein/beta-1B-glycoprotein//hemopexin/HX
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Bovine Hemopexin, HPX ELISA KIT
ELI-06384b	Lifescience Market	96 Tests	EUR 928.00

Human Hemopexin, HPX ELISA KIT
ELI-06385h	Lifescience Market	96 Tests	EUR 824.00

Mouse Hemopexin, Hpx ELISA KIT
ELI-06386m	Lifescience Market	96 Tests	EUR 865.00

Rat Hemopexin, Hpx ELISA KIT
ELI-06387r	Lifescience Market	96 Tests	EUR 886.00

Porcine Hemopexin, HPX ELISA KIT
ELI-06388p	Lifescience Market	96 Tests	EUR 928.00

Chicken Hemopexin, HPX ELISA KIT
ELI-06389c	Lifescience Market	96 Tests	EUR 928.00

Human Hemopexin(HPX) ELISA kit
CSB-EL010723HU-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hemopexin (HPX) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

This study augments the use of metabonomics based on HS-GC-IMS in research studies. Using this method, there is no need to pre-process samples by extraction or derivatization, and the VOC component of the sample can be detected directly and rapidly. In conclusion, this study establishes a simple, convenient, and fast technique, which can help identify clinical biomarkers for rapid medical diagnosis.