The aim of this study was to investigate the differences in volatile organic compounds (VOCs) obtained from the feces of a Baihe Jizihuang Tang (BHT)-treated rat depression model. Rats were subjected to chronic unpredictable mild stress (CUMS), and the differences in VOCs were analyzed by headspace-gas chromatography-ion mobility spectrometry (HS-GC-IMS), NIST software, principal component analysis, and orthogonal partial least squares discriminant analysis.
Eleven biomarkers were identified on the basis of VOC migration time, and their relative peak intensities were analyzed. A metabonomic model was established using multivariate statistical analysis.
The study demonstrated the metabonomics of CUMS rats and the intervention effect of BHT and also highlighted the potential therapeutic effects of the traditional Chinese medicine (TCM) Jingfang for the clinical treatment of complex diseases, which was in line with the holistic and systemic approaches of TCM.
Rat Hemopexin (HPX) ELISA Kit |
DLR-HPX-Ra-48T |
DL Develop |
48T |
EUR 528.00 |
- Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids. |
Rat Hemopexin (HPX) ELISA Kit |
DLR-HPX-Ra-96T |
DL Develop |
96T |
EUR 690.00 |
- Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids. |
Human Hemopexin (HPX) ELISA Kit |
RDR-HPX-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 455.00 |
Human Hemopexin (HPX) ELISA Kit |
RDR-HPX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 629.00 |
Rat Hemopexin (HPX) ELISA Kit |
RDR-HPX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558.00 |
Rat Hemopexin (HPX) ELISA Kit |
RDR-HPX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776.00 |
Human Hemopexin (HPX) ELISA Kit |
RD-HPX-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436.00 |
Human Hemopexin (HPX) ELISA Kit |
RD-HPX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601.00 |
Rat Hemopexin (HPX) ELISA Kit |
RD-HPX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534.00 |
Rat Hemopexin (HPX) ELISA Kit |
RD-HPX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742.00 |
Mouse Hemopexin (Hpx) ELISA kit 96 tests, Quantitative |
600-700-HPX |
Alpha Diagnostics |
1 Kit |
EUR 773.00 |
HPX Antibody |
32919-100ul |
SAB |
100ul |
EUR 252.00 |
HPX Antibody |
1-CSB-PA14619A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
HPX Antibody |
DF7415 |
Affbiotech |
200ul |
EUR 304.00 |
Description: HPX Antibody detects endogenous levels of total HPX. |
HPX antibody |
70R-33157 |
Fitzgerald |
100 ug |
EUR 435.00 |
Description: Rabbit polyclonal HPX antibody |
Hpx Antibody |
1-CSB-PA010723LA01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
HPX siRNA |
20-abx902527 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HPX siRNA |
20-abx919837 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HPX siRNA |
20-abx919838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rat Hemopexin (Hpx) |
1-CSB-EP010723RA |
Cusabio |
- EUR 505.00
- EUR 265.00
- EUR 1827.00
- EUR 766.00
- EUR 1218.00
- EUR 335.00
|
|
- MW: 52.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Hemopexin(Hpx) expressed in E.coli |
Rat Hemopexin (Hpx) |
1-CSB-YP010723RA |
Cusabio |
- EUR 504.00
- EUR 265.00
- EUR 1832.00
- EUR 763.00
- EUR 1216.00
- EUR 334.00
|
|
- MW: 50.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Hemopexin(Hpx) expressed in Yeast |
HPX Blocking Peptide |
DF7415-BP |
Affbiotech |
1mg |
EUR 195.00 |
Hemopexin (HPX) Antibody |
abx018663-100ul |
Abbexa |
100 ul |
EUR 342.00 |
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody |
20-abx004282 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody |
20-abx176803 |
Abbexa |
|
|
|
Hemopexin (HPX) Antibody |
20-abx176804 |
Abbexa |
|
|
|
Hemopexin (HPX) Antibody |
20-abx100261 |
Abbexa |
- EUR 356.00
- EUR 133.00
- EUR 996.00
- EUR 495.00
- EUR 300.00
|
|
- Shipped within 5-7 working days.
|
Hemopexin (HPX) Antibody |
20-abx100262 |
Abbexa |
- EUR 356.00
- EUR 133.00
- EUR 996.00
- EUR 495.00
- EUR 300.00
|
|
- Shipped within 5-7 working days.
|
Hemopexin (HPX) Antibody |
20-abx100263 |
Abbexa |
- EUR 314.00
- EUR 133.00
- EUR 843.00
- EUR 439.00
- EUR 272.00
|
|
- Shipped within 5-7 working days.
|
Hemopexin (HPX) Antibody |
20-abx110423 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody |
abx037974-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody |
20-abx130204 |
Abbexa |
- EUR 439.00
- EUR 133.00
- EUR 1247.00
- EUR 592.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Hemopexin (HPX) Antibody |
20-abx141489 |
Abbexa |
- EUR 370.00
- EUR 606.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody |
20-abx172765 |
Abbexa |
|
|
|
Hemopexin (HPX) Antibody |
20-abx172766 |
Abbexa |
|
|
|
Hemopexin (HPX) Antibody |
20-abx172767 |
Abbexa |
|
|
|
Hemopexin (HPX) Antibody |
abx032918-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody |
abx032918-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
HPX Conjugated Antibody |
C32919 |
SAB |
100ul |
EUR 397.00 |
Hemopexin (HPX) Antibody |
abx233829-100ug |
Abbexa |
100 ug |
EUR 551.00 |
- Shipped within 5-12 working days.
|
Hemopexin (HPX) Antibody |
20-abx302284 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
HPX cloning plasmid |
CSB-CL010723HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: atggctagggtactgggagcacccgttgcactggggttgtggagcctatgctggtctctggccattgccacccctcttcctccgactagtgcccatgggaatgttgctgaaggcgagaccaagccagacccagacgtgactgaacgctgctcagatggctggagctttgatgctac
- Show more
|
Description: A cloning plasmid for the HPX gene. |
Hpx Polyclonal Antibody |
A52880 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
HPX Rabbit pAb |
A5603-100ul |
Abclonal |
100 ul |
EUR 308.00 |
HPX Rabbit pAb |
A5603-200ul |
Abclonal |
200 ul |
EUR 459.00 |
HPX Rabbit pAb |
A5603-20ul |
Abclonal |
20 ul |
EUR 183.00 |
HPX Rabbit pAb |
A5603-50ul |
Abclonal |
50 ul |
EUR 223.00 |
Recombinant Hemopexin (HPX) |
4-RPB986Hu01 |
Cloud-Clone |
- EUR 413.60
- EUR 214.00
- EUR 1276.00
- EUR 492.00
- EUR 884.00
- EUR 340.00
- EUR 3040.00
|
|
- Uniprot ID: P02790
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Hemopexin expressed in: E.coli |
Recombinant Hemopexin (HPX) |
4-RPB986Hu02 |
Cloud-Clone |
- EUR 413.60
- EUR 214.00
- EUR 1276.00
- EUR 492.00
- EUR 884.00
- EUR 340.00
- EUR 3040.00
|
|
- Uniprot ID: P02790
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 18.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Hemopexin expressed in: E.coli |
Recombinant Hemopexin (HPX) |
4-RPB986Ra01 |
Cloud-Clone |
- EUR 422.56
- EUR 216.00
- EUR 1309.60
- EUR 503.20
- EUR 906.40
- EUR 346.00
- EUR 3124.00
|
|
- Uniprot ID: P20059
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Hemopexin expressed in: E.coli |
Recombinant Hemopexin (HPX) |
4-RPB986Ra02 |
Cloud-Clone |
- EUR 422.56
- EUR 216.00
- EUR 1309.60
- EUR 503.20
- EUR 906.40
- EUR 346.00
- EUR 3124.00
|
|
- Uniprot ID: P20059
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Hemopexin expressed in: E.coli |
Anti-HPX antibody |
STJ27570 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. |
Hpx sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6850703 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Hpx sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3830503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
HPX sgRNA CRISPR Lentivector (Human) (Target 2) |
K0988303 |
ABM |
1.0 ug DNA |
EUR 154.00 |
HPX Antibody, HRP conjugated |
1-CSB-PA14619B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HPX Antibody, FITC conjugated |
1-CSB-PA14619C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HPX Antibody, Biotin conjugated |
1-CSB-PA14619D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
HPX protein (His tag) |
80R-3694 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Purified recombinant HPX protein (His tag) |
Hemopexin (HPX) Antibody (Biotin) |
20-abx106143 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody (FITC) |
20-abx107557 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody (HRP) |
20-abx108976 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Human Hemopexin (HPX) Protein |
20-abx067049 |
Abbexa |
- EUR 578.00
- EUR 258.00
- EUR 1720.00
- EUR 690.00
- EUR 425.00
|
|
- Shipped within 5-12 working days.
|
Rat Hemopexin (HPX) Protein |
20-abx067050 |
Abbexa |
- EUR 592.00
- EUR 258.00
- EUR 1776.00
- EUR 704.00
- EUR 439.00
|
|
- Shipped within 5-12 working days.
|
Human Hemopexin (HPX) Protein |
20-abx067051 |
Abbexa |
- EUR 578.00
- EUR 258.00
- EUR 1720.00
- EUR 690.00
- EUR 425.00
|
|
- Shipped within 5-12 working days.
|
Rat Hemopexin (HPX) Protein |
20-abx067052 |
Abbexa |
- EUR 592.00
- EUR 258.00
- EUR 1776.00
- EUR 704.00
- EUR 439.00
|
|
- Shipped within 5-12 working days.
|
Human HPX ELISA Kit |
EHH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Goat HPX ELISA Kit |
EGTH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Bovine HPX ELISA Kit |
EBH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Canine HPX ELISA Kit |
ECH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Chicken HPX ELISA Kit |
ECKH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Anserini HPX ELISA Kit |
EAH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Rat HPX shRNA Plasmid |
20-abx985920 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyclonal HPX / Hemopexin Antibody |
APR07793G |
Leading Biology |
0.1mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications: |
Polyclonal HPX / Hemopexin Antibody |
APR07794G |
Leading Biology |
0.05mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications: |
Polyclonal HPX / Hemopexin Antibody |
APR07795G |
Leading Biology |
0.05ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications: |
Polyclonal HPX Antibody (Center) |
APR07796G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX (Center). This antibody is tested and proven to work in the following applications: |
Hpx Antibody, HRP conjugated |
1-CSB-PA010723LB01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA |
Hpx Antibody, FITC conjugated |
1-CSB-PA010723LC01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA |
Hpx Antibody, Biotin conjugated |
1-CSB-PA010723LD01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Hemopexin (HPX) Antibody (Biotin) |
20-abx271774 |
Abbexa |
- EUR 398.00
- EUR 230.00
- EUR 1080.00
- EUR 537.00
- EUR 314.00
|
|
- Shipped within 5-15 working days.
|
Hemopexin (HPX) Antibody (Biotin) |
20-abx273085 |
Abbexa |
- EUR 467.00
- EUR 244.00
- EUR 1344.00
- EUR 634.00
- EUR 356.00
|
|
- Shipped within 5-15 working days.
|
Hemopexin (HPX) Antibody (HRP) |
20-abx316139 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody (FITC) |
20-abx316140 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Hemopexin (HPX) Antibody (Biotin) |
20-abx316141 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Cow Hemopexin (HPX) Protein |
20-abx653714 |
Abbexa |
- EUR 648.00
- EUR 272.00
- EUR 1998.00
- EUR 773.00
- EUR 467.00
|
|
- Shipped within 5-15 working days.
|
Human HPX shRNA Plasmid |
20-abx952232 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse HPX shRNA Plasmid |
20-abx970889 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat HPX ELISA Kit |
ERH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Sheep HPX ELISA Kit |
ESH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Rabbit HPX ELISA Kit |
ERTH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Mouse HPX ELISA Kit |
EMH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Monkey HPX ELISA Kit |
EMKH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Porcine HPX ELISA Kit |
EPH0117 |
Abclonal |
96Tests |
EUR 521.00 |
HPX Recombinant Protein (Human) |
RP015217 |
ABM |
100 ug |
Ask for price |
HPX Recombinant Protein (Rat) |
RP205049 |
ABM |
100 ug |
Ask for price |
HPX Recombinant Protein (Mouse) |
RP142346 |
ABM |
100 ug |
Ask for price |
Human Hemopexin, HPX ELISA Kit |
DEIA255 |
Creative Diagnostics |
5 plates |
EUR 1361.00 |
Description: The human HPX ELISA kit is for the quantitative determination of human HPX. |
Pig HPX/ Hemopexin ELISA Kit |
E0088Pi |
Sunlong |
1 Kit |
EUR 717.00 |
Human Hemopexin (HPX) CLIA Kit |
20-abx190171 |
Abbexa |
- EUR 7911.00
- EUR 4215.00
- EUR 973.00
|
|
- Shipped within 5-7 working days.
|
Rat Hemopexin (HPX) CLIA Kit |
abx197132-96tests |
Abbexa |
96 tests |
EUR 825.00 |
- Shipped within 5-12 working days.
|
Rat Hemopexin (HPX) ELISA Kit |
20-abx155626 |
Abbexa |
- EUR 7378.00
- EUR 3933.00
- EUR 911.00
|
|
- Shipped within 5-7 working days.
|
Human Hemopexin (HPX) ELISA Kit |
20-abx151794 |
Abbexa |
- EUR 6173.00
- EUR 3291.00
- EUR 770.00
|
|
- Shipped within 5-7 working days.
|
Rat Hemopexin (HPX) ELISA Kit |
abx255717-96tests |
Abbexa |
96 tests |
EUR 707.00 |
- Shipped within 5-12 working days.
|
Chicken Hemopexin (HPX) ELISA Kit |
20-abx258512 |
Abbexa |
- EUR 7378.00
- EUR 3933.00
- EUR 911.00
|
|
- Shipped within 5-7 working days.
|
Mouse Hemopexin (HPX) ELISA Kit |
20-abx258513 |
Abbexa |
- EUR 7237.00
- EUR 3855.00
- EUR 895.00
|
|
- Shipped within 5-7 working days.
|
Human Hemopexin (HPX) ELISA Kit |
abx251358-96tests |
Abbexa |
96 tests |
EUR 707.00 |
- Shipped within 5-12 working days.
|
Guinea Pig HPX ELISA Kit |
EGH0117 |
Abclonal |
96Tests |
EUR 521.00 |
Human HPX/ Hemopexin ELISA Kit |
E1162Hu |
Sunlong |
1 Kit |
EUR 571.00 |
Human HPX(Hemopexin) ELISA Kit |
EH2031 |
FN Test |
96T |
EUR 524.10 |
- Detection range: 1.563-100 ng/ml
- Uniprot ID: P02790
- Alias: HPX(Hemopexin)/Beta-1B-glycoprotein/beta-1B-glycoprotein//hemopexin/HX
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human Hemopexin(HPX) ELISA kit |
CSB-EL010723HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165.00 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Hemopexin (HPX) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
This study augments the use of metabonomics based on HS-GC-IMS in research studies. Using this method, there is no need to pre-process samples by extraction or derivatization, and the VOC component of the sample can be detected directly and rapidly. In conclusion, this study establishes a simple, convenient, and fast technique, which can help identify clinical biomarkers for rapid medical diagnosis.